Replication, Transcription, and Translation of DNA & RNA

Transcription

DNA or deoxyribeonucleicacid is the code for life, it contains the instructions for the production of proteins which do various operations in the cell. DNA by nature is a polymer(macromolecule) and consist of four nucleotide bases(adenine,guanine,cytosine,and thymine).It also contains sugar and phosphate groups as a backbone.

There is a general rule in molecule bonds in DNA

A & G are purines C & T are pyrimidines

A--->T(and U if its RNA) & C--->G

DNA is basically the raw code. It is unusable in making proteins until it is coded into something else called "mRNA" mRNA is created when the DNA double helix is unwinded by helicase(an enzyme). afterward stranding RNA nucleotides(AUCG, not T) link with one of the helix's strands, Once mRNA is coded for translation can begin.

if we had a strand of DNA that was [ACGACGACAGACGTTTTCGAGACAGAC] The complementary RNA strand would be [UGCUGCUGUCUGCAAAAGCUCUGUCUG]

Translation

Each three nucleotides counts as a codon or protein coder(ex. are methionine, and lysine)

with our newly coded strand of mRNA we can being translation and produce a fully functional "polypeptide chain" or protein chain. The proteins are located on the ribosomes called tRNA or transport RNA which transports the proteins so they can link up with their complementary mRNA codons

If we had a codon

|GCG||CCG|

the complementary tRNA would be protein₁{CGC} + protein₂{GGC} = polypeptide chain(ex. hemoglobin)

Replication

When a cell divides, it undergoes a process called mitosis and in the "S" phase of this cycle, DNA replicates, for replication and ultimately mitosis to take place (DNA must replicate). There are certain steps to this process. The first step is that DNA must be unwound by an enzyme called helicase. Afterwards, proteins link with the strands to make sure they don't bond back together. DNA polymerase comes into action next. It supplies complementary nucleotides from DNA 5' to 3' end. The leading strand replicates properly, but the lagging strand does not. It is formed in pieces called Okazaki fragments.