Fatty acid chains determine the flexibility of the membrane

Fatty acid chains determine the flexibility of the membrane

Shorter fatty acid chains prefer a liquid.

• Longer fatty acid chains prefer a solid state.
• Double bonds make fatty acid chains prefer a liquid state.
• Bacteria have enzymes that adapt to changing temperatures. If you increase the temperature of the bacteria, the bacteria will use enzymes to increase the length of the phospholipid chains and decrease the number of double bonds.

Phospholipid bilayer

Phospholipid bilayer 

The head group points towards the outside of the membrane while the tail group is hydrophobic and points inward. There are some very common fatty acid side chains (R groups: R1 and R2) including:

1. palmitate, 16 carbon saturated fatty acid chain.
2. oleate, an 18 carbon unsaturated fatty acid chain with a single double bond.
3. sterate, an 18 carbon saturated fatty acid chain.

Saturated bonds are very flexible but double bonds create kinks and limit flexibility.

Phospholipids have a amphipathic property or nonpolar and polar properties.

Membrane Properties

Membrane Properties:Selective Permeability

The phospholipid membrane itself does not allow polar or charged species to flow through it. There are channels, permeases, that allow charged and polar substances entry and exit from the cell.

Oxidative Phosphorylation in Mitochondria

Outer membrane allows passive transport of small molecules through porin (simple channel).

• Inner membrane actively transports protons from the matrix (central area) into the intermembrane space.
• ATPase is associated with a pore forming structure on inner membrane when protons are actively transported out. ATP is consumed when protons are transported out into the intermembrane space.
• However, when the gradient reverses the protons flow in from the intermembrane space into the matrix. This causes the generation of ATP from ADP.

Mechanically Deformable

Membranes can be deformed because they are fluid. Hence fluid-mosaic model. This property comes from the phospholipid bilayer. A membrane is pictured as a mosaic because it has various protein molecules embedded in the phospholipid bilayer .

Communication

Membranes serve in cell-cell communication and signal transduction in the nervous and muscular systems

How Can We Isolate a Membrane?

How Can We Isolate a Membrane?

Study cells in pieces with membrane fractionation.

1. This process involves taking tissue or cells and rupturing their cell membranes using a technique called vigorous homogenization (very similar to using a mortar and pestle). This produces pieces of membrane and organelles called lysate.
2. Centrifuge to separate pieces which will settle at different rates: Nucleus first, Endoplasmic Reticulum last. Using centrifuging to separate cell parts is called differential centrifugation and it separates lysate according to mass.
3. A sucrose gradient, a gradient is created using an increasing concentration of sucrose as you move down the centrifuge tube. When the lysate is added to this tube and centrifuged, the lysate travels to the point where it's density is matched by the surrounding sucrose.

Homologous Chromosomes

Definitions

Homologous chromosomes — chromosomes that contain the same genes.

• Maternal homologues — chromosomes from the original female parent.
• Paternal homologues — chromosomes from the original male parent.
• The diagram shows a chromosome.
• Each of the strands is a chromatid.
• Chromosomal crossover — the process by which two chromosomes pair up and exchange sections of their DNA.

Stages of meiosis

Prophase I — Homologous pairs of chromosomes in a diploid cell pair up forming bivalents. Chromosomal crossover occurs.

• Metaphase I — Bivalents line across equator of the spindle opposite homolguos pair of chromosomes.
• Anaphase I —
• Telophase I —
• Interphase —
• Prophase II —
• Metaphase II —
• Anaphase II —
• Telophase II —

Replication, Transcription, and Translation of DNA & RNA

Transcription

DNA or deoxyribeonucleicacid is the code for life, it contains the instructions for the production of proteins which do various operations in the cell. DNA by nature is a polymer(macromolecule) and consist of four nucleotide bases(adenine,guanine,cytosine,and thymine).It also contains sugar and phosphate groups as a backbone.

There is a general rule in molecule bonds in DNA

A & G are purines C & T are pyrimidines

A--->T(and U if its RNA) & C--->G

DNA is basically the raw code. It is unusable in making proteins until it is coded into something else called "mRNA" mRNA is created when the DNA double helix is unwinded by helicase(an enzyme). afterward stranding RNA nucleotides(AUCG, not T) link with one of the helix's strands, Once mRNA is coded for translation can begin.

if we had a strand of DNA that was [ACGACGACAGACGTTTTCGAGACAGAC] The complementary RNA strand would be [UGCUGCUGUCUGCAAAAGCUCUGUCUG]

Translation

Each three nucleotides counts as a codon or protein coder(ex. are methionine, and lysine)

with our newly coded strand of mRNA we can being translation and produce a fully functional "polypeptide chain" or protein chain. The proteins are located on the ribosomes called tRNA or transport RNA which transports the proteins so they can link up with their complementary mRNA codons

If we had a codon

|GCG||CCG|

the complementary tRNA would be protein₁{CGC} + protein₂{GGC} = polypeptide chain(ex. hemoglobin)

Replication

When a cell divides, it undergoes a process called mitosis and in the "S" phase of this cycle, DNA replicates, for replication and ultimately mitosis to take place (DNA must replicate). There are certain steps to this process. The first step is that DNA must be unwound by an enzyme called helicase. Afterwards, proteins link with the strands to make sure they don't bond back together. DNA polymerase comes into action next. It supplies complementary nucleotides from DNA 5' to 3' end. The leading strand replicates properly, but the lagging strand does not. It is formed in pieces called Okazaki fragments.

Cell Division

When a cell divides it must go through a process called mitosis. Mitosis is a process that describes the various steps that occur in a cell before and after initial division

The cell cycle as its most commonly called consist of the

• G₁- cell growth begins
• S- Protein synthesis and chromosomal replication occurs
• G₂- cell now has duplicate copies of chromosomes
• M Phase- centrioles lock onto each end of the chromosomes and then pull them apart to make two cells

Terms (chromosome - super coiled DNA wounded together with histones)

All of the above is moderated by two molecules called "CDK-Cyclin"